Quick Order

Text Size:AAA

Mouse CUTC Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CUTCcDNA Clone Product Information
cDNA Size:819
cDNA Description:ORF Clone of Mus musculus cutC copper transporter homolog (E.coli) DNA.
Gene Synonym:CGI-32; AI326282; 2310039I18Rik
Restriction Site:
Tag Sequence:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-untagged Vector Information
Vector Name pCMV3-untagged
Vector Size 6223bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-untagged Physical Map

Schematic of pCMV3-untagged Multiple Cloning Sites
Related Products
Product nameProduct name

Copper homeostasis protein cutC homolog, also known as CGI-32 and CUTC, is a cytoplasm and nucleus protein which belongs to the CutC family. CUTC may play a role in copper homeostasis. It can bind one Cu1+ per subunit. Copper is an essential trace element to life and particularly plays a pivotal role in the physiology of aerobic organisms. Copper is a micronutrient that is required for proper metabolic functioning of most prokaryotic and eukaryotic organisms. To sustain an adequate supply of copper, a cell requires molecular mechanisms that control the metal content to avoid copper toxicity. This toxicity comes primarily from the reactivity of copper, which can lead to the generation of free radicals. In bacteria, two independent systems are responsible for maintaining the balance of copper within the cells ( Cop and Cut family proteins ). The Cut protein family is associated with copper homeostasis and involved in uptake, storage, delivery, and efflux of copper. CutC is a member of the Cut family and is suggested to be involved in efflux trafficking of cuprous ion. CutC is able to respond transcriptionally to copper and to participate in the control of copper homeostasis in E. faecalis.

  • Lai C.-H., et al., 2000, Genome Res.10:703-713.
  • Li J., et al., 2005, Biochem. Biophys. Res. Commun. 337:179-183.
  • Li,Y. et al., 2010, J Struct Biol. 169 (3):399-405.
  • Burkard T.R., et al., 2011, BMC Syst. Biol. 5:17-17.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items