Quick Order

Text Size:AAA

Mouse HEXA natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse HEXA cDNA Clone Product Information
Gene_bank_ref_id:NM_010421.4
RefSeq ORF Size:1587bp
cDNA Description:Full length Clone DNA of Mus musculus hexosaminidase A.
Gene Synonym:Hex-1
Species:Mouse
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
References
  • Norflus,F. et al., 1996, DNA Cell Biol. 15 (2):89-97.
  • Kaufman M., et al., 1997, Hum. Mutat. 10:295-300.
  • Tanaka A., et al., 2003, J. Hum. Genet. 48:571-574.
  • Chen R., et al., 2009, J. Proteome Res. 8:651-661.
  • Burkard T.R., et al., 2011, BMC Syst. Biol. 5:17-17.
  • Size / Price
    Catalog: MG53109-UT
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"