Quick Order

Mouse ALDOB Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
ALDOBcDNA Clone Product Information
Gene_bank_ref_id:NM_144903.2
cDNA Size:1095
cDNA Description:ORF Clone of Mus musculus aldolase B, fructose-bisphosphate DNA.
Gene Synonym:Aldo2; Aldo-2; BC016435
Species:Mouse
Vector:pCMV3-untagged
Restriction Site:
Tag Sequence:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-untagged Vector Information
 
Vector Name pCMV3-untagged
Vector Size 6223bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-untagged Physical Map

Schematic of pCMV3-untagged Multiple Cloning Sites
Related Products
Product nameProduct name
References
  • Cox TM. (1994) Aldolase B and fructose intolerance. FASEB J. 8(1): 62-71.
  • Malay AD, et al. (2005) Structure of the thermolabile mutant aldolase B, A149P: molecular basis of hereditary fructose intolerance. J Mol Biol. 347(1): 135-44.
  • Susan PP, et al. (2001) Starvation-induced lysosomal degradation of aldolase B requires glutamine 111 in a signal sequence for chaperone-mediated transport. J Cell Physiol. 187(1): 48-58.
  • Size / Price
    Catalog:MG53101-UT
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
    Images
      Recently Viewed Items
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"