Quick Order

Text Size:AAA

Mouse RPRD1B Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
RPRD1BcDNA Clone Product Information
cDNA Size:663
cDNA Description:ORF Clone of Mus musculus regulation of nuclear pre-mRNA domain containing 1B DNA.
Gene Synonym:Crept; 2610304G08Rik; 2810446G03Rik
Restriction Site:
Tag Sequence:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-untagged Vector Information
Vector Name pCMV3-untagged
Vector Size 6223bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-untagged Physical Map

Schematic of pCMV3-untagged Multiple Cloning Sites
Related Products
Product nameProduct name

RPRD1B, together with RPRD1A, can accompany RNAP II from promoter regions to 3'-untranslated regions during transcription in vivo, predominantly interact with phosphorylated RNAP II, and can reduce CTD S5- and S7-phosphorylated RNAP II at target gene promoters. RNA polymerase II C-terminal domain (CTD) phosphorylation is important for various transcription-related processes. RPRD1B is a transcriptional regulator which enhances expression of CCND1. It also enhances the transcription of a number of other cell cycle-related genes including CDK2, CDK4, CDK6 and cyclin-E but not CDKN1A, CDKN1B or cyclin-A.

  • Ni Z. et al., 2011, Transcription. 2 (5): 237-42.
  • Kristensen AR. et al., 2012, Nat Methods. 9 (9): 907-9.
  • Woods NT. et al., 2012, Sci Signal.5 (242): rs6.