Quick Order

Text Size:AAA

Influenza A H5N8 (A/breeder duck/Korea/Gochang1/2014(Gochang1)) Nucleocapsid protein / NP ORF mammalian expression plasmid (Codon Optimized)

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
H5N8 NP cDNA Clone Product Information
Gene_bank_ref_id:
RefSeq ORF Size:1497bp
cDNA Description:Full length Clone DNA of Influenza A H5N8 (A/breeder duck/Korea/Gochang1/2014(Gochang1)) Nucleocapsid protein DNA.
Gene Synonym:Nucleocapsid protein, NP
Species:H5N8
Vector:pCMV/hygro
Plasmid:pCMV-H5N8-BG-14-NP
Restriction Site:KpnI + XbaI (5.5kb + 1.5kb)
Tag Sequence:
Sequence Description:A number of silent mutations were introduced into the DNA sequence in order to increase its protein expression level in mammalian cell system. The translated amino acid sequence is identical with AHL21420.1.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
H5N8 NP Gene Plasmid Map
Influenza A H5N8 (A/breeder duck/Korea/Gochang1/2014(Gochang1)) Nucleocapsid protein / NP Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
 
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)


Schematic of pCMV/hygro Multiple Cloning Sites
Influenza A H5N8 (A/breeder duck/Korea/Gochang1/2014(Gochang1)) Nucleocapsid protein / NP ORF mammalian expression plasmid (Codon Optimized) on other vectors
Product nameProduct name
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"