Quick Order

Text Size:AAA

Influenza B (B/Hong Kong/05/1972) Hemagglutinin / HA Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
HAcDNA Clone Product Information
cDNA Size:1749
cDNA Description:ORF Clone of Influenza B (B/Hong Kong/05/1972) Hemagglutinin DNA.
Gene Synonym:Hemagglutinin, HA
Species:Influenza B
Restriction Site:HindIII+ XbaI
Tag Sequence:
Sequence Description:A number of silent mutations were introduced into the DNA sequence in order to increase its protein expression level in mammalian cell system. The translated amino acid sequence is identical with ABF21280.1.
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Influenza B (B/Hong Kong/05/1972) Hemagglutinin / HA Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, untagged on other vectors
Related Products
Product nameProduct name
Size / Price
List Price: $315.00  (Save $0.00)
Price:$315.00      [How to order]
Availability5 Business days
  • Influenza B (B/Hong Kong/05/1972) Hemagglutinin / HA Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, untagged
Recently Viewed Items