Quick Order

Influenza A H5N8 (A/broiler duck/Korea/Buan2/2014(Buan2)) Hemagglutinin / HA Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
HAcDNA Clone Product Information
cDNA Size:1704
cDNA Description:ORF Clone of Influenza A H5N8 (A/broiler duck/Korea/Buan2/2014(Buan2)) Hemagglutinin DNA.
Gene Synonym:Hemagglutinin, HA
Restriction Site:HindIII + XbaI
Tag Sequence:
Sequence Description:A number of silent mutations were introduced into the DNA sequence in order to increase its protein expression level in mammalian cell system. The translated amino acid sequence is identical with AHL21407.1.
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-untagged Vector Information
Vector Name pCMV3-untagged
Vector Size 6223bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-untagged Physical Map

Schematic of pCMV3-untagged Multiple Cloning Sites
Influenza A H5N8 (A/broiler duck/Korea/Buan2/2014(Buan2)) Hemagglutinin / HA Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, untagged on other vectors
Related Products
Product nameProduct name
Size / Price
List Price: $315.00  (Save $0.00)
Price:$315.00      [How to order]
Availability5 Business days