Quick Order

Influenza B (B/Florida/4/2006) Nucleocapsid protein / NP (Codon Optimized) ORF mammalian expression plasmid, N-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Influenza B NP cDNA Clone Product Information
Gene_bank_ref_id:
RefSeq ORF Size:1683bp
cDNA Description:Full length Clone DNA of Influenza B (B/Florida/4/2006) Nucleocapsid protein with N terminal HA tag.
Gene Synonym:Nucleocapsid protein, NP
Species:Influenza B
Vector:pCMV3-N-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:A number of silent mutations were introduced into the DNA sequence in order to increase its protein expression level in mammalian cell system. The translated amino acid sequence is identical with ACF54251.1.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Influenza B (B/Florida/4/2006) Nucleocapsid protein / NP (Codon Optimized) ORF mammalian expression plasmid, N-HA tag on other vectors
Influenza B (B/Florida/4/2006) Nucleocapsid protein / NP ORF mammalian expression plasmid (Codon Optimized), C-GFPSpark tagVG40438-ACG$345
Influenza B (B/Florida/4/2006) Nucleocapsid protein / NP (Codon Optimized) ORF mammalian expression plasmid, C-OFPSpark / RFP tagVG40438-ACR$345
Influenza B (B/Florida/4/2006) Nucleocapsid protein / NP ORF mammalian expression plasmid, N-GFPSpark tagVG40438-ANG$345
Influenza B (B/Florida/4/2006) Nucleocapsid protein / NP (Codon Optimized) ORF mammalian expression plasmid, N-OFPSpark / RFP tagVG40438-ANR$345
Influenza B (B/Florida/4/2006) Nucleocapsid protein / NP (Codon Optimized) ORF mammalian expression plasmid, C-Flag tagVG40438-CF$315
Influenza B (B/Florida/4/2006) Nucleocapsid protein / NP (Codon Optimized) ORF mammalian expression plasmid, C-His tagVG40438-CH$315
Influenza B (B/Florida/4/2006) Nucleocapsid protein / NP (Codon Optimized) ORF mammalian expression plasmid, C-Myc tagVG40438-CM$315
Influenza B (B/Florida/4/2006) Nucleocapsid protein / NP (Codon Optimized) ORF mammalian expression plasmid, C-HA tagVG40438-CY$315
Influenza B (B/Florida/4/2006) Nucleocapsid protein / NP ORF mammalian expression plasmid (Codon Optimized)VG40438-G$115
Influenza B (B/Florida/4/2006) Nucleocapsid protein / NP (Codon Optimized) ORF mammalian expression plasmid, N-Flag tagVG40438-NF$315
Influenza B (B/Florida/4/2006) Nucleocapsid protein / NP (Codon Optimized) ORF mammalian expression plasmid, N-His tagVG40438-NH$315
Influenza B (B/Florida/4/2006) Nucleocapsid protein / NP (Codon Optimized) ORF mammalian expression plasmid, N-Myc tagVG40438-NM$315
Influenza B (B/Florida/4/2006) Nucleocapsid protein / NP (Codon Optimized) ORF mammalian expression plasmid, N-HA tagVG40438-NY$315
Influenza B (B/Florida/4/2006) Nucleocapsid protein / NP ORF mammalian expression plasmid (Codon Optimized)VG40438-UT$315
 Learn more about expression Vectors
Product nameProduct name
Size / Price
Catalog: VG40438-NY
List Price:   (Save )
Price:      [How to order]
Availability2-3 weeksShipping instructions
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"