Quick Order

Influenza B (B/Florida/4/2006) Nucleocapsid protein / NP Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, N-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
NPcDNA Clone Product Information
cDNA Size:1683
cDNA Description:ORF Clone of Influenza B (B/Florida/4/2006) Nucleocapsid protein DNA.
Gene Synonym:Nucleocapsid protein, NP
Species:Influenza B
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-N-His Vector Information
Vector Name pCMV3-N-His
Vector Size 6104bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-N-His Physical Map

Schematic of pCMV3-N-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Influenza B (B/Florida/4/2006) Nucleocapsid protein / NP Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, N-His-tagged on other vectors
Influenza B (B/Florida/4/2006) Nucleocapsid protein / NP Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, C-GFPSpark-taggedVG40438-ACG$345
Influenza B (B/Florida/4/2006) Nucleocapsid protein / NP Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, C-OFPSpark tagVG40438-ACR$345
Influenza B (B/Florida/4/2006) Nucleocapsid protein / NP Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, N-GFPSpark-taggedVG40438-ANG$345
Influenza B (B/Florida/4/2006) Nucleocapsid protein / NP Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, N-OFPSpark tagVG40438-ANR$345
Influenza B (B/Florida/4/2006) Nucleocapsid protein / NP Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, C-FLAG-taggedVG40438-CF$315
Influenza B (B/Florida/4/2006) Nucleocapsid protein / NP Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, C-His-taggedVG40438-CH$315
Influenza B (B/Florida/4/2006) Nucleocapsid protein / NP Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, C-Myc-taggedVG40438-CM$315
Influenza B (B/Florida/4/2006) Nucleocapsid protein / NP Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, C-HA-taggedVG40438-CY$315
Influenza B (B/Florida/4/2006) Nucleocapsid protein / NP Gene cDNA Clone (Codon Optimized, full-length ORF Clone)VG40438-G$115
Influenza B (B/Florida/4/2006) Nucleocapsid protein / NP Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, N-FLAG-taggedVG40438-NF$315
Influenza B (B/Florida/4/2006) Nucleocapsid protein / NP Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, N-His-taggedVG40438-NH$315
Influenza B (B/Florida/4/2006) Nucleocapsid protein / NP Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, N-Myc-taggedVG40438-NM$315
Influenza B (B/Florida/4/2006) Nucleocapsid protein / NP Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, N-HA-taggedVG40438-NY$315
Influenza B (B/Florida/4/2006) Nucleocapsid protein / NP Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, untaggedVG40438-UT$315
 Learn more about expression Vectors
Related Products
Product nameProduct name
Size / Price
List Price: $315.00  (Save $0.00)
Price:$315.00      [How to order]
Availability2-3 weeks