Quick Order

Influenza A H6N6 (A/duck/Eastern China/11/2009) Hemagglutinin / HA (Codon Optimized) ORF mammalian expression plasmid, N-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
 HA cDNA Clone Product Information
Gene_bank_ref_id:
RefSeq ORF Size:1701bp
cDNA Description:Full length Clone DNA of Influenza A H6N6 (A/duck/Eastern China/11/2009) Hemagglutinin with N terminal His tag.
Gene Synonym:Hemagglutinin, HA
Species:H6N6
Vector:pCMV3-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:A number of silent mutations were introduced into the DNA sequence in order to increase its protein expression level in mammalian cell system. The translated amino acid sequence is identical with AEF59343.1.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Influenza A H6N6 (A/duck/Eastern China/11/2009) Hemagglutinin / HA (Codon Optimized) ORF mammalian expression plasmid, N-His tag on other vectors
Influenza A H6N6 (A/duck/Eastern China/11/2009) Hemagglutinin / HA ORF mammalian expression plasmid (Codon Optimized), C-GFPSpark tagVG40399-ACG$345
Influenza A H6N6 (A/duck/Eastern China/11/2009) Hemagglutinin / HA (Codon Optimized) ORF mammalian expression plasmid, C-OFPSpark / RFP tagVG40399-ACR$345
Influenza A H6N6 (A/duck/Eastern China/11/2009) Hemagglutinin / HA (Codon Optimized) ORF mammalian expression plasmid, C-Flag tagVG40399-CF$315
Influenza A H6N6 (A/duck/Eastern China/11/2009) Hemagglutinin / HA (Codon Optimized) ORF mammalian expression plasmid, C-His tagVG40399-CH$315
Influenza A H6N6 (A/duck/Eastern China/11/2009) Hemagglutinin / HA (Codon Optimized) ORF mammalian expression plasmid, C-Myc tagVG40399-CM$315
Influenza A H6N6 (A/duck/Eastern China/11/2009) Hemagglutinin / HA (Codon Optimized) ORF mammalian expression plasmid, C-HA tagVG40399-CY$315
Influenza A H6N6 (A/duck/Eastern China/11/2009) Hemagglutinin / HA ORF mammalian expression plasmid (Codon Optimized)VG40399-G$115
Influenza A H6N6 (A/duck/Eastern China/11/2009) Hemagglutinin / HA (Codon Optimized) ORF mammalian expression plasmid, N-Flag tagVG40399-NF$315
Influenza A H6N6 (A/duck/Eastern China/11/2009) Hemagglutinin / HA (Codon Optimized) ORF mammalian expression plasmid, N-His tagVG40399-NH$315
Influenza A H6N6 (A/duck/Eastern China/11/2009) Hemagglutinin / HA (Codon Optimized) ORF mammalian expression plasmid, N-Myc tagVG40399-NM$315
Influenza A H6N6 (A/duck/Eastern China/11/2009) Hemagglutinin / HA (Codon Optimized) ORF mammalian expression plasmid, N-HA tagVG40399-NY$315
Influenza A H6N6 (A/duck/Eastern China/11/2009) Hemagglutinin / HA ORF mammalian expression plasmid (Codon Optimized)VG40399-UT$315
 Learn more about expression Vectors
Product nameProduct name
Size / Price
Catalog: VG40399-NH
List Price:   (Save )
Price:      [How to order]
Availability2-3 weeksShipping instructions
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"