Quick Order

Text Size:AAA

Influenza A H6N1 (A/quail/Hong Kong/1721-30/99) Hemagglutinin / HA ORF mammalian expression plasmid (Codon Optimized)

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
H6N1 HA cDNA Clone Product Information
Gene_bank_ref_id:
RefSeq ORF Size:1704bp
cDNA Description:Full length Clone DNA of Influenza A H6N1 (A/quail/Hong Kong/1721-30/99) Hemagglutinin.
Gene Synonym:Hemagglutinin, HA
Species:H6N1
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:A number of silent mutations were introduced into the DNA sequence in order to increase its protein expression level in mammalian cell system. The translated amino acid sequence is identical with CAC84981.1.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
Influenza A H6N1 (A/quail/Hong Kong/1721-30/99) Hemagglutinin / HA ORF mammalian expression plasmid (Codon Optimized) on other vectors
Influenza A H6N1 (A/quail/Hong Kong/1721-30/99) Hemagglutinin / HA ORF mammalian expression plasmid (Codon Optimized), C-GFPSpark tagVG40397-ACG$345
Influenza A H6N1 (A/quail/Hong Kong/1721-30/99) Hemagglutinin / HA (Codon Optimized) ORF mammalian expression plasmid, C-OFPSpark / RFP tagVG40397-ACR$345
Influenza A H6N1 (A/quail/Hong Kong/1721-30/99) Hemagglutinin / HA (Codon Optimized) ORF mammalian expression plasmid, C-Flag tagVG40397-CF$315
Influenza A H6N1 (A/quail/Hong Kong/1721-30/99) Hemagglutinin / HA (Codon Optimized) ORF mammalian expression plasmid, C-His tagVG40397-CH$315
Influenza A H6N1 (A/quail/Hong Kong/1721-30/99) Hemagglutinin / HA (Codon Optimized) ORF mammalian expression plasmid, C-Myc tagVG40397-CM$315
Influenza A H6N1 (A/quail/Hong Kong/1721-30/99) Hemagglutinin / HA (Codon Optimized) ORF mammalian expression plasmid, C-HA tagVG40397-CY$315
Influenza A H6N1 (A/quail/Hong Kong/1721-30/99) Hemagglutinin / HA ORF mammalian expression plasmid (Codon Optimized)VG40397-G$115
Influenza A H6N1 (A/quail/Hong Kong/1721-30/99) Hemagglutinin / HA (Codon Optimized) ORF mammalian expression plasmid, N-Flag tagVG40397-NF$315
Influenza A H6N1 (A/quail/Hong Kong/1721-30/99) Hemagglutinin / HA (Codon Optimized) ORF mammalian expression plasmid, N-His tagVG40397-NH$315
Influenza A H6N1 (A/quail/Hong Kong/1721-30/99) Hemagglutinin / HA (Codon Optimized) ORF mammalian expression plasmid, N-Myc tagVG40397-NM$315
Influenza A H6N1 (A/quail/Hong Kong/1721-30/99) Hemagglutinin / HA (Codon Optimized) ORF mammalian expression plasmid, N-HA tagVG40397-NY$315
Influenza A H6N1 (A/quail/Hong Kong/1721-30/99) Hemagglutinin / HA ORF mammalian expression plasmid (Codon Optimized)VG40397-UT$315
 Learn more about expression Vectors
Product nameProduct name
Size / Price
Catalog: VG40397-UT
List Price:   (Save )
Price:      [How to order]
Availability2-3 weeksShipping instructions
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"