Quick Order

Influenza A H1N1 (A/California/07/2009) Nucleoprotein / NP ORF mammalian expression plasmid (Codon Optimized)

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
H1N1 NP cDNA Clone Product Information
Gene_bank_ref_id:
RefSeq ORF Size:1497bp
cDNA Description:Full length Clone DNA of Influenza A H1N1 (A/California/07/2009) Nucleoprotein / NP.
Gene Synonym:Nucleoprotein, NP
Species:H1N1
Vector:pCMV3-untagged
Plasmid:pCMV3-H1N1-C-07-NP
Restriction Site:KpnI + XbaI (6.1kb + 1.5kb)
Tag Sequence:
Sequence Description:A number of silent mutations were introduced into the DNA sequence in order to increase its protein expression level in mammalian cell system. The translated amino acid sequence is identical with ACS94534.1.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
Influenza A H1N1 (A/California/07/2009) Nucleoprotein / NP ORF mammalian expression plasmid (Codon Optimized) on other vectors
Product nameProduct name
Size / Price
Catalog: VG40205-UT
List Price:   (Save )
Price:      [How to order]
AvailabilityIn Stock Shipping instructions
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"