Quick Order

Human PTH natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human PTH cDNA Clone Product Information
Gene_bank_ref_id:NM_000315.2
RefSeq ORF Size:348bp
cDNA Description:Full length Clone DNA of Homo sapiens parathyroid hormone.
Gene Synonym:PTH1
Species:Human
Vector:pCMV3-untagged
Plasmid:pCMV3-PTH
Restriction Site:KpnI + XbaI (6.1kb + 0.35kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Background

Parathyroid hormone (PTH), parathormone or parathyrin, is secreted by the chief cells of the parathyroid glands as a polypeptide. PTH elevates calcium level by dissolving the salts in bone and preventing their renal excretion. Parathyroid hormone (PTH) has been proved to play a pivotal role in maintaining myocardial contractility as well as effective natriuresis, and possible pathogenic mechanisms contributing to heart failure secondary to hypocalcemia and hypoparathyroidism. With the increased population of preosteoblastic lineages and the osteoblastic activation, Parathyroid hormone (PTH) drives anabolism in bone. Experiments have recently reported that PTH affects bone cells in a dual pathway - mediating osteoblastic (preosteoblastic) activities or osteocytic synthesis of sclerostin. Defects in PTH are a cause of familial isolated hypoparathyroidism (FIH), also called autosomal dominant hypoparathyroidism or autosomal dominant hypocalcemia. FIH is characterized by hypocalcemia and hyperphosphatemia due to inadequate secretion of parathyroid hormone. Symptoms are seizures, tetany and cramps.

References
  • Bedi B, et al. (2012) Silencing of parathyroid hormone (PTH) receptor 1 in T cells blunts the bone anabolic activity of PTH. Proc Natl Acad Sci U S A. 109(12): 725-33.
  • Hasegawa T, et al. (2012) Parathyroid hormone as a Bone anabolic agent. Biological function of bone cells on the PTH-driven anabolic effect. Clin Calcium. 22(3): 373-9.
  • Ito M. Parathyroid hormone as a Bone anabolic agent. Effect of PTH on bone structural properties. Clin Calcium. 22(3): 335-41.
  • Size / Price
    Catalog: HG13192-UT
    List Price:   (Save )
    Price:      [How to order]
    AvailabilityIn Stock Shipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"