After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Human ALDH3B2 natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human ALDH3B2 cDNA Clone Product Information
NCBI RefSeq:BC007685
RefSeq ORF Size:1158bp
cDNA Description:Full length Clone DNA of Homo sapiens aldehyde dehydrogenase 3 family, member B2.
Gene Synonym:ALDH8
Species:Human
Vector:pCMV3-untagged
Plasmid:pCMV3-ALDH3B2
Restriction Site:HindIII + XbaI (6.1kb + 1.16kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human ALDH3B2 Gene Plasmid Map
Human ALDH3B2 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Human ALDH3B2 natural ORF mammalian expression plasmid on other vectors
Product nameProduct name
Size / Price
Catalog: HG12515-UT
List Price:   (Save )
Price:      [How to order]
AvailabilityIn Stock Shipping instructions
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"