Quick Order

Influenza A H2N2 (A/Japan/305/1957) Matrix protein 1 / M1 ORF mammalian expression plasmid (Codon Optimized)

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
H2N2 M1 cDNA Clone Product Information
Gene_bank_ref_id:
RefSeq ORF Size:759bp
cDNA Description:Full length Clone DNA of Influenza A H2N2 (A/Japan/305/1957) Matrix protein 1 / M1.
Gene Synonym:Matrix protein 1, M1
Species:H2N2
Vector:pCMV3-untagged
Plasmid:pCMV3-H2N2-J-57-M1
Restriction Site:KpnI + XbaI (6.1kb + 0.76kb)
Tag Sequence:
Sequence Description:The translated amino acid sequence is identical with Q6XU11.1
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
Influenza A H2N2 (A/Japan/305/1957) Matrix protein 1 / M1 ORF mammalian expression plasmid (Codon Optimized) on other vectors
Product nameProduct name
Size / Price
Catalog: VG40214-UT
List Price:   (Save )
Price:      [How to order]
AvailabilityIn Stock Shipping instructions
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"