After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Influenza A H1N1 (A/Puerto Rico/8/1934) Matrix protein 1 / M1 ORF mammalian expression plasmid (Codon Optimized)

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
H1N1 M1 cDNA Clone Product Information
Gene_bank_ref_id:NC_002016.1
RefSeq ORF Size:759bp
cDNA Description:Full length Clone DNA of Influenza A H1N1 (A/Puerto Rico/8/1934) Matrix protein 1 / M1.
Gene Synonym:Matrix protein 1, M1
Species:H1N1
Vector:pCMV3-untagged
Plasmid:pCMV3-H1N1-PR-34-M1
Restriction Site:KpnI + XbaI (6.1kb + 0.76kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for the point mutations: 33T/A, 510C/T, 630G/A not causing the amino acid variation.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
Influenza A H1N1 (A/Puerto Rico/8/1934) Matrix protein 1 / M1 ORF mammalian expression plasmid (Codon Optimized) on other vectors
Product nameProduct name
Size / Price
Catalog: VG40010-UT
List Price:   (Save )
Price:      [How to order]
AvailabilityIn Stock Shipping instructions
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"