Quick Order

Text Size:AAA

pCMV3-SP-N-His Negative Control Vector (N-terminal His-tagged)

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
pCMV3-SP-N-His Negative Control Vector (N-terminal His-tagged)Related Products & Topics
Related Products
Research Topics
    Size / Price
    Catalog:CV023
    List Price: $120.00  (Save $0.00)
    Price:$120.00      [How to order]
    Availability5 Business days
    • Negative control for the pCMV3-SP-N-His clone.
    • Vector sequence is the same as pCMV3-SP-N-His, but multiple cloning sites are removed.
    • Designed for mammalian expression, stable or transient.
    • Hygromycin resistance gene for selection of stable cell lines.
     
    pCMV3-SP-N-His-NCV (Negative Control Vector) Physical Map
     
    Vector Sequence
    Download     
     
    Description
     
     Vector Name pCMV3-SP-N-His-NCV
     Vector Size

    6064bp

     Vector Type Mammalian Expression Vector
     Expression Method Constitutive, Stable / Transient
     Promoter CMV
     Antibiotic Resistance Kanamycin
     Selection In Mammalian Cells Hygromycin
     Protein Tag His
     Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
    Reverse:BGH(TAGAAGGCACAGTCGAGG)
     
    Schematic of pCMV3-SP-N-His-NCV (Negative Control Vector) Multiple Cloning Sites

    Images
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"