After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

pCMV3-N-His Negative Control Vector (N-terminal His-tagged)

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
  • Negative control for the pCMV3-N-His clone.
  • Vector sequence is the same as pCMV3-N-His, but multiple cloning sites are removed.
  • Designed for mammalian expression, stable or transient.
  • Hygromycin resistance gene for selection of stable cell lines.
 
pCMV3-N-His-NCV (Negative Control Vector) Physical Map
 
Vector Sequence
Download     
 
Description
 
 Vector Name pCMV3-N-His-NCV
 Vector Size

6019bp

 Vector Type Mammalian Expression Vector
 Expression Method Constitutive, Stable / Transient
 Promoter CMV
 Antibiotic Resistance Kanamycin
 Selection In Mammalian Cells Hygromycin
 Protein Tag His
 Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)
 
Schematic of pCMV3-N-His-NCV (Negative Control Vector) Multiple Cloning Sites

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"