Quick Order

Ebola virus EBOV (subtype Bundibugyo, strain Uganda 2007) glycoprotein (Codon Optimized) ORF mammalian expression plasmid, C-Myc tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
EBOV EBOV-G cDNA Clone Product Information
Gene_bank_ref_id:
RefSeq ORF Size:2031bp
cDNA Description:Full length Clone DNA of Ebola virus EBOV (subtype Bundibugyo, strain Uganda 2007) glycoprotein with C terminal Myc tag.
Gene Synonym:EBOV-G
Species:EBOV
Vector:pCMV3-C-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Ebola virus EBOV (subtype Bundibugyo, strain Uganda 2007) glycoprotein (Codon Optimized) ORF mammalian expression plasmid, C-Myc tag on other vectors
Ebola virus EBOV (subtype Bundibugyo, strain Bundibugyo 2007) glycoprotein ORF mammalian expression plasmid (Codon Optimized), C-GFPSpark tagVG40368-ACG$345
Ebola virus EBOV (subtype Bundibugyo, strain Bundibugyo 2007) glycoprotein (Codon Optimized) ORF mammalian expression plasmid, C-OFPSpark / RFP tagVG40368-ACR$345
Ebola virus EBOV (subtype Bundibugyo, strain Uganda 2007) glycoprotein ORF mammalian expression plasmid (Codon Optimized), C-Flag tagVG40368-CF$315
Ebola virus EBOV (subtype Bundibugyo, strain Bundibugyo 2007) glycoprotein (Codon Optimized) ORF mammalian expression plasmid, C-His tagVG40368-CH$315
Ebola virus EBOV (subtype Bundibugyo, strain Uganda 2007) glycoprotein (Codon Optimized) ORF mammalian expression plasmid, C-Myc tagVG40368-CM$315
Ebola virus EBOV (subtype Bundibugyo, strain Uganda 2007) glycoprotein (Codon Optimized) ORF mammalian expression plasmid, C-HA tagVG40368-CY$315
Ebola virus EBOV (subtype Bundibugyo, strain Bundibugyo 2007) glycoprotein ORF mammalian expression plasmid (Codon Optimized)VG40368-G$115
Ebola virus EBOV (subtype Bundibugyo, strain Uganda 2007) glycoprotein (Codon Optimized) ORF mammalian expression plasmid, N-Flag tagVG40368-NF$315
Ebola virus EBOV (subtype Bundibugyo, strain Uganda 2007) glycoprotein (Codon Optimized) ORF mammalian expression plasmid, N-His tagVG40368-NH$315
Ebola virus EBOV (subtype Bundibugyo, strain Uganda 2007) glycoprotein (Codon Optimized) ORF mammalian expression plasmid, N-Myc tagVG40368-NM$315
Ebola virus EBOV (subtype Bundibugyo, strain Uganda 2007) glycoprotein (Codon Optimized) ORF mammalian expression plasmid, N-HA tagVG40368-NY$315
Ebola virus EBOV (subtype Bundibugyo, strain Uganda 2007) glycoprotein ORF mammalian expression plasmid (Codon Optimized)VG40368-UT$315
 Learn more about expression Vectors
Product nameProduct name
Background

The fourth gene of the EBOV genome encodes a 160-kDa envelope-attached glycoprotein (GP) and a 110 kDa secreted glycoprotein (sGP). Both GP and sGP have an identical 295-residue N-terminus, however, they have different C-terminal sequences. Recently, great attention has been paid to GP for vaccines design and entry inhibitors isolation. GP is a class I fusion protein which assembles as trimers on viral surface and plays an important role in virus entry and attachment. Mature GP is a disulfide-linked heterodimer formed by two subunits, GP1 and GP2, which are generated from the proteolytical process of GP precursor (pre-GP) by cellular furin during virus assembly . The GP1 subunit contains a mucin domain and a receptor-binding domain (RBD); the GP2 subunit has a fusion peptide, a helical heptad-repeat (HR) region, a transmembrane (TM) domain, and a 4-residue cytoplasmic tail. The RBD of GP1 mediates the interaction of EBOV with cellular receptor (e.g. DC-SIGN/LSIGN, TIM-1, hMGL, NPC1, β-integrins, folate receptor-α, and Tyro3 family receptors), of which TIM1 and NPC1 are essential for EBOV entry; the mucin domain having N- and O-linked glycans enhances the viral attachment to cellular hMGL, and participates in shielding key neutralization epitopes, which helps the virus evades immune elimination. There are large conformation changes of GP2 during membrane fusion, which enhance the insertion of fusion loop into cellular membrane and facilitate the release of viral nucleocapsid core to cytoplasm.

References
  1. Volchkov VE, et al. Processing of the Ebola virus glycoprotein by the proprotein convertase furin. Proc Natl Acad Sci U S A. 1998 May 12;95(10):5762-7.
  2. Lee JE, et al. Structure of the Ebola virus glycoprotein bound to an antibody from a human survivor. Nature. 2008 Jul 10;454(7201):177-82. doi: 10.1038/nature07082.
  3. Hood CL, et al. Biochemical and structural characterization of cathepsin L-processed Ebola virus glycoprotein: implications for viral entry and immunogenicity. J Virol. 2010 Mar;84(6):2972-82. doi: 10.1128/JVI.02151-09.
  4. Cook JD and Lee JE. The secret life of viral entry glycoproteins: moonlighting in immune evasion. PLoS Pathog. 2013 May;9(5):e1003258. doi: 10.1371/journal.ppat.1003258.
  5. Miller EH and Chandran K. Filovirus entry into cells - new insights. Curr Opin Virol. 2012 Apr;2(2):206-14. doi: 10.1016/j.coviro.2012.02.015.
Size / Price
Catalog: VG40368-CM
List Price:   (Save )
Price:      [How to order]
Availability2-3 weeksShipping instructions
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"