Quick Order

Mouse RELA ORF mammalian expression plasmid, N-Flag tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse RELA cDNA Clone Product Information
Gene_bank_ref_id:NM_009045.4
RefSeq ORF Size:1650bp
cDNA Description:Full length Clone DNA of Mus musculus v-rel reticuloendotheliosis viral oncogene homolog A (avian) with N terminal Flag tag.
Gene Synonym:p65
Species:Mouse
Vector:pCMV3-N-FLAG
Plasmid:
Restriction Site:
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
Background

RELA (v-rel reticuloendotheliosis viral oncogene homolog A), also known as Nuclear factor NF-kappa-B p65 subunit, or Transcription factor p65, is a transcription factor expressed in growth plate chondrocytes where it facilitates chondrogenesis. The v-rel avian reticuloendotheliosis viral oncogene homolog A (RELA) gene encodes the major component of the NF-?B complex. NF-kappaB is a generic name for an evolutionarily conserved transcription-factor system that contributes to the mounting of an effective immune response but is also involved in the regulation of cell proliferation, development, and apoptosis. The implication of NF-kappaB in central biological processes and its extraordinary connectivity to other signaling pathways raise a need for highly controlled regulation of NF-kappaB activity at several levels. The mammalian Rel/NF-kappaB family of transcription factors, including RelA, c-Rel, RelB, NF-kappaB1 (p50 and its precursor p105), and NF-kappaB2 (p52 and its precursor p100), plays a central role in the immune system by regulating several processes ranging from the development and survival of lymphocytes and lymphoid organs to the control of immune responses and malignant transformation.

References
  • Hashimoto R, et al. (2011) Variants of the RELA gene are associated with schizophrenia and their startle responses. Neuropsychopharmacology. 36(9): 1921-31.
  • Vallabhapurapu S, et al. (2009) Regulation and function of NF-kappaB transcription factors in the immune system. Annu Rev Immunol. 27: 693-733.
  • Schmitz ML, et al. (2004) NF-kappaB: a multifaceted transcription factor regulated at several levels. Chembiochem. 5(10): 1348-58.
  • Size / Price
    Catalog: MG53057-NF
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"