Quick Order

Mouse AKR1A1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
AKR1A1cDNA Clone Product Information
Gene_bank_ref_id:NM_021473.3
cDNA Size:978
cDNA Description:ORF Clone of Mus musculus aldo-keto reductase family 1, member A1 (aldehyde reductase) DNA.
Gene Synonym:Akr1a4; 2610201A18Rik
Species:Mouse
Vector:pCMV3-N-FLAG
Restriction Site:
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-N-FLAG Vector Information
 
Vector Name pCMV3-N-FLAG
Vector Size 6098bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-N-FLAG Physical Map
Schematic of pCMV3-N-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Related Products
Product nameProduct name
Background

Aldehyde reductase (AKR1A1) is a member of the aldo-keto reductase superfamily, which consists of more than 40 known enzymes and proteins that includes variety of monomeric NADPH-dependent oxidoreductases, such as aldehyde reductase. Aldehyde reductase has wide substrate specificities for carbonyl compounds. These enzymes are implicated in the development of diabetic complications by catalyzing the reduction of glucose to sorbitol. Aldehyde reductase possess a structure with a beta-alpha-beta fold which contains a novel NADP-binding motif. The binding site is located in a large, deep, elliptical pocket in the C-terminal end of the beta sheet, the substrate being bound in an extended conformation. This binding is more similar to FAD- than to NAD(P)-binding oxidoreductases. AKR1A1 is involved in the reduction of biogenic and xenobiotic aldehydes and is present in virtually every tissue.

References
  • Bohren KM, et al. (1989) The aldo-keto reductase superfamily. cDNAs and deduced amino acid sequences of human aldehyde and aldose reductases. J Biol Chem. 264 (16): 9547-51.
  • Fujii J, et al. (1999) The structural organization of the human aldehyde reductase gene, AKR1A1, and mapping to chromosome. Cytogenetics and Cell Genetics . 84 (3-4): 33-2.
  • Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"