Quick Order

Cynomolgus monkey UBA1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
UBA1cDNA Clone Product Information
Gene_bank_ref_id:unsubmitted
cDNA Size:3177
cDNA Description:ORF Clone of Macaca fascicularis ubiquitin-like modifier activating enzyme 1DNA.
Gene Synonym:UBA1
Species:Cynomolgus
Vector:pCMV3-C-FLAG
Restriction Site:
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-FLAG Vector Information
 
Vector Name pCMV3-C-FLAG
Vector Size 6158bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-C-FLAG Physical Map
Schematic of pCMV3-C-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Cynomolgus monkey UBA1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-tagged on other vectors
Cynomolgus monkey UBA1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedCG90821-ACG$425
Cynomolgus monkey UBA1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagCG90821-ACR$425
Cynomolgus monkey UBA1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedCG90821-ANG$425
Cynomolgus monkey UBA1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-OFPSpark tagCG90821-ANR$425
Cynomolgus monkey UBA1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedCG90821-CF$395
Cynomolgus monkey UBA1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedCG90821-CH$395
Cynomolgus monkey UBA1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedCG90821-CM$395
Cynomolgus monkey UBA1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedCG90821-CY$395
Cynomolgus monkey UBA1 Gene cDNA Clone (full-length ORF Clone)CG90821-G$145
Cynomolgus monkey UBA1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedCG90821-NF$395
Cynomolgus monkey UBA1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedCG90821-NH$395
Cynomolgus monkey UBA1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedCG90821-NM$395
Cynomolgus monkey UBA1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedCG90821-NY$395
Cynomolgus monkey UBA1 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedCG90821-UT$395
 Learn more about expression Vectors
Related Products
Product nameProduct name
Background

UBE1, also known as UBA1, belongs to the ubiquitin-activating E1 family. UBE1 gene complements an X-linked mouse temperature-sensitive defect in DNA synthesis, and thus may function in DNA repair. It is part of a gene cluster on chromosome Xp11.23. UBE1 catalyzes the first step in ubiquitin conjugation to mark cellular proteins for degradation. It also catalyzes the first step in ubiquitin conjugation to mark cellular proteins for degradation by first adenylating its C-terminal glycine residue with ATP, and thereafter linking this residue to the side chain of a cysteine residue in E1, yielding an ubiquitin-E1 thioester and free AMP. Defects in UBA1 can cause spinal muscular atrophy X-linked type 2 (SMAX2), also known as X-linked lethal infantile spinal muscular atrophy, distal X-linked arthrogryposis multiplex congenita or X-linked arthrogryposis type 1 (AMCX1). Spinal muscular atrophy refers to a group of neuromuscular disorders characterized by degeneration of the anterior horn cells of the spinal cord, leading to symmetrical muscle weakness and atrophy. SMAX2 is a lethal infantile form presenting with hypotonia, areflexia, and multiple congenital contractures.

References
  • Jin J, et al. (2007) Dual E1 activation systems for ubiquitin differentially regulate E2 enzyme charging. Nature. 447(7148):1135-8.
  • Xia T, et al. (2007) Chaperone-dependent E3 ligase CHIP ubiquitinates and mediates proteasomal degradation of soluble guanylyl cyclase. Am J Physiol Heart Circ Physiol. 293(5):H3080-7.
  • Pridgeon JW, et al. (2009) Proteomic analysis reveals Hrs UIM-mediated ubiquitin signaling in multiple cellular processes. FEBS J. 276(1):118-31.
  • Size / Price
    Catalog:CG90821-CF
    List Price: $395.00  (Save $0.00)
    Price:$395.00      [How to order]
    Availability2-3 weeks
    Images
      Recently Viewed Items
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"