After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Mouse UBE2I Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
UBE2IcDNA Clone Product Information
cDNA Size:477
cDNA Description:ORF Clone of Mus musculus ubiquitin-conjugating enzyme E2I DNA.
Gene Synonym:UBC9; Ubce9; Ubce2i; 5830467E05Rik; F830028O17Rik
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-FLAG Vector Information
Vector Name pCMV3-C-FLAG
Vector Size 6158bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-FLAG Physical Map
Schematic of pCMV3-C-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Related Products
Product nameProduct name

UBE2I is a member of the ubiquitin-conjugating E2 family whose members perform the second step in the ubiquitination reaction. Initially identified as the main process for protein degradation, ubiquitination is believed nowadays to be crucial for a wider range of cellular processes. The outcome of the ubiquitin-conjugation reaction, and thereby the fate of the substrate, is heavily dependent on the number of ubiquitin molecules attached and how these ubiquitin molecules are inter-connected. To deal with this complexity and to allow adequate ubiquitination in time and space, a highly sophisticated conjugation machinery has been developed. In a sequential manner, ubiquitin becomes activated by an ubiquitin-activating enzyme (E1), which then transfers the ubiquitin to a group of ubiquitin-conjugating enzymes (E2s). Next, ubiquitin-loaded E2s are interacting with ubiquitin protein ligases (E3s) and ubiquitin is conjugated to substrates on recruitment by the E3. These three key enzymes are operating in a hierarchical system, wherein two E1s and 35 E2s have been found and hundreds of E3s have been identified in humans. 

  • Sjoerd J L van Wijk, et al. (2009) A comprehensive framework of E2-RING E3 interactions of the human ubiquitin-proteasome system. Mol Syst Biol. 5: 317.
  • Nandi D, et al. (2006) The ubiquitin-proteasome system. Journal of biosciences. 31 (1): 137-55.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items