Quick Order

Text Size:AAA

Mouse AFP Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
AFPcDNA Clone Product Information
cDNA Size:1818
cDNA Description:ORF Clone of Mus musculus alpha fetoprotein DNA.
Gene Synonym:Afp
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Vector Information
Vector Name pCMV3-SP-N-Myc
Vector Size 6149bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Multiple Cloning Sites

Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Related Products
Product nameProduct name

Alpha-fetoprotein (AFP) is classified as a member of the albuminoid gene superfamily consisting of albumin, AFP, vitamin D (Gc) protein, and alpha-albumin. AFP is a glycoprotein of 591 amino acids and a carbohydrate moiety. AFP is one of the several embryo-specific proteins and is a dominant serum protein as early in human embryonic life as one month, when albumin and transferrin are present in relatively small amounts. It is first synthesized in the human by the yolk sac and liver(1-2 months) and subsequently predominantly in the liver. A small amount of AFP is produced by the GI tract of the human conceptus. It has been proved that AFP may reappear in the serum in elevated amounts in adult life in association with normal restorative processes and with malignant growth. Alpha-fetoprotein (AFP) is a specific marker for hepatocellular carcinoma (HCC), teratoblastomas, and neural tube defect (NTD).

  • Mizejewski GJ. (2001) Alpha-fetoprotein Structure and Function: Relevance to Isoforms, Epitopes, and Conformational Variants. Exp Biol Med. 226(5): 377-408.
  • Tomasi TB, et al. (1977) Structure and Function of Alpha-Fetoprotein. Annual Review of Medicine. 28: 453-65.
  • Leguy MC, et al. (2011) Assessment of AFP in amniotic fluid: comparison of three automated techniques. Ann Biol Clin. 69(4): 441-6.
  • Size / Price
    List Price: $315.00  (Save $0.00)
    Price:$315.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items