Quick Order

Text Size:AAA

Cynomolgus monkey OTUB1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
OTUB1cDNA Clone Product Information
cDNA Size:816
cDNA Description:ORF Clone of Macaca fascicularis OTU domain, ubiquitin aldehyde binding 1DNA.
Gene Synonym:OTUB1
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-Myc Vector Information
Vector Name pCMV3-C-Myc
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-Myc Physical Map

Schematic of pCMV3-C-Myc Multiple Cloning Sites

Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Cynomolgus monkey OTUB1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-tagged on other vectors
Cynomolgus monkey OTUB1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedCG90812-ACG$325
Cynomolgus monkey OTUB1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagCG90812-ACR$325
Cynomolgus monkey OTUB1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedCG90812-ANG$325
Cynomolgus monkey OTUB1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-OFPSpark tagCG90812-ANR$325
Cynomolgus monkey OTUB1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedCG90812-CF$295
Cynomolgus monkey OTUB1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedCG90812-CH$295
Cynomolgus monkey OTUB1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedCG90812-CM$295
Cynomolgus monkey OTUB1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedCG90812-CY$295
Cynomolgus monkey OTUB1 Gene cDNA Clone (full-length ORF Clone)CG90812-G$95
Cynomolgus monkey OTUB1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedCG90812-NF$295
Cynomolgus monkey OTUB1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedCG90812-NH$295
Cynomolgus monkey OTUB1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedCG90812-NM$295
Cynomolgus monkey OTUB1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedCG90812-NY$295
Cynomolgus monkey OTUB1 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedCG90812-UT$295
 Learn more about expression Vectors
Related Products
Product nameProduct name

Ubiquitin thioesterase OTUB1, also known as Deubiquitinating enzyme OTUB1, OTU domain-containing ubiquitin aldehyde-binding protein 1, Otubain-1, Ubiquitin-specific-processing protease OTUB1, OTUB1 and OTB1, is a cytoplasm protein which belongs to the peptidase C65 family. OTUB1 is a hydrolase that can remove conjugated ubiquitin from proteins and plays an important regulatory role at the level of protein turnover by preventing degradation. OTUB1 is a regulator of T-cell anergy, a phenomenon that occurs when T-cells are rendered unresponsive to antigen rechallenge and no longer respond to their cognate antigen. OTUB1 acts via its interaction with RNF128 / GRAIL, a crucial inductor of CD4 T-cell anergy. Isoform 1 of OTUB1 destabilizes RNF128, leading to prevent anergy. In contrast, isoform 2 of OTUB1 stabilizes RNF128 and promotes anergy. OTUB1 regulates RNF128-mediated ubiquitination, but does not deubiquitinate polyubiquitinated RNF128. Deubiquitinates estrogen receptor alpha (ESR1). OTUB1 mediates deubiquitination of 'Lys-48'-linked polyubiquitin chains, but not 'Lys-63'-linked polyubiquitin chains. OTUB1 is also capable of removing NEDD8 from NEDD8 conjugates, but with a much lower preference compared to 'Lys-48'-linked ubiquitin.

  • Balakirev M.Y., et al., 2003, EMBO Rep. 4:517-522.
  • Soares L., et al., 2004, Nat. Immunol. 5:45-54.
  • Stanisic V., et al., 2009, J. Biol. Chem. 284:16135-16145.
  • Choudhary C., et al., 2009, Science 325:834-840.
  • Edelmann M.J., et al., 2009, Biochem. J. 418:379-390.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items