Quick Order

Text Size:AAA

Mouse UBE2I ORF mammalian expression plasmid, C-Myc tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse UBE2I cDNA Clone Product Information
Gene_bank_ref_id:NM_001177610.1
RefSeq ORF Size:477bp
cDNA Description:Full length Clone DNA of Mus musculus ubiquitin-conjugating enzyme E2I with C terminal Myc tag.
Gene Synonym:UBC9, Ubce9, Ubce2i, 5830467E05Rik, F830028O17Rik
Species:Mouse
Vector:pCMV3-C-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

UBE2I is a member of the ubiquitin-conjugating E2 family whose members perform the second step in the ubiquitination reaction. Initially identified as the main process for protein degradation, ubiquitination is believed nowadays to be crucial for a wider range of cellular processes. The outcome of the ubiquitin-conjugation reaction, and thereby the fate of the substrate, is heavily dependent on the number of ubiquitin molecules attached and how these ubiquitin molecules are inter-connected. To deal with this complexity and to allow adequate ubiquitination in time and space, a highly sophisticated conjugation machinery has been developed. In a sequential manner, ubiquitin becomes activated by an ubiquitin-activating enzyme (E1), which then transfers the ubiquitin to a group of ubiquitin-conjugating enzymes (E2s). Next, ubiquitin-loaded E2s are interacting with ubiquitin protein ligases (E3s) and ubiquitin is conjugated to substrates on recruitment by the E3. These three key enzymes are operating in a hierarchical system, wherein two E1s and 35 E2s have been found and hundreds of E3s have been identified in humans. 

References
  • Sjoerd J L van Wijk, et al. (2009) A comprehensive framework of E2-RING E3 interactions of the human ubiquitin-proteasome system. Mol Syst Biol. 5: 317.
  • Nandi D, et al. (2006) The ubiquitin-proteasome system. Journal of biosciences. 31 (1): 137-55.
  • Size / Price
    Catalog: MG52988-CM
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"