Quick Order

Text Size:AAA

Mouse GSTM2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
GSTM2cDNA Clone Product Information
Gene_bank_ref_id:NM_008183.3
cDNA Size:657
cDNA Description:ORF Clone of Mus musculus glutathione S-transferase, mu 2 DNA.
Gene Synonym:Gstb2; Gstb-2
Species:Mouse
Vector:pCMV3-C-Myc
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-Myc Vector Information
 
Vector Name pCMV3-C-Myc
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-C-Myc Physical Map

Schematic of pCMV3-C-Myc Multiple Cloning Sites

Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Related Products
Product nameProduct name
Background

Glutathione S-transferase Mu 2, also known as GST class-mu 2, GSTM2-2 and GSTM2, is a cytoplasm protein which belongs to the GST superfamily and Mu family. GSTM2 / GST4 contains one GST C-terminal domain and one GST N-terminal domain. The glutathione S-transferases (GSTs) are a multigene family of enzymes largely involved in the detoxification of chemicals. Eight distinct classes of the soluble cytoplasmic mammalian glutathione S-transferases have been identified: alpha, kappa, mu, omega, pi, sigma, theta and zeta. Butyrate, an important luminal component produced from fermentation of dietary fibers, is an efficient inducer of GSTs and especially of GSTM2. Butyrate may act chemoprotectively by increasing detoxification capabilities in the colon mucosa.

References
  • Campbell E, et al.,1990, J Biol Chem 265 (16): 9188-93. 
  • Vorachek WR, et al.,1991, Proc Natl Acad Sci USA. 88 (10): 4443-7.
  • Ebert,M.N. et al., 2003, Carcinogenesis. 24 (10):1637-44.
  • Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"