After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Mouse YWHAQ Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
YWHAQcDNA Clone Product Information
cDNA Size:738
cDNA Description:ORF Clone of Mus musculus tyrosine 3-monooxygenase>tryptophan 5-monooxygenase activation protein, theta polypeptide DNA.
Gene Synonym:R74690; AA409740; AU021156; 2700028P07Rik
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-His Vector Information
Vector Name pCMV3-C-His
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-His Physical Map

Schematic of pCMV3-C-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Related Products
Product nameProduct name
  • Cheng Y, et al. (2010) Effect of 14-3-3 tau protein on differentiation in BeWo choriocarcinoma cells. Placenta. 31(1): 60-6.
  • Umahara T, et al. (2010) 14-3-3 proteins and spinocerebellar ataxia type 1: from molecular interaction to human neuropathology. Cerebellum. 9(2): 183-9.
  • Wang B, et al. (2004) A role for 14-3-3 tau in E2F1 stabilization and DNA damage-induced apoptosis. J Biol Chem. 279(52): 54140-52.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items