After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Mouse C1D Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
C1DcDNA Clone Product Information
cDNA Size:426
cDNA Description:ORF Clone of Mus musculus C1D nuclear receptor co-repressor DNA.
Gene Synonym:SUN-CoR; AI875855; 1110036E10Rik
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-His Vector Information
Vector Name pCMV3-C-His
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-His Physical Map

Schematic of pCMV3-C-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Related Products
Product nameProduct name

C1D nuclear receptor corepressor belongs to the C1D family. It is a DNA binding and apoptosis-inducing protein.C1D nuclear receptor corepressorinteracts with TSNAX and DNA-PKcs. It acts as a corepressor for the thyroid hormone receptor. It is thought that C1D nuclear receptor corepressor regulates TRAX/Translin complex formation. It is expressed in kidney, heart, brain, spleen, lung, testis, liver and small intestine. It plays a role in the recruitment of the RNA exosome complex to pre-rRNA to mediate the 3'-5' end processing of the 5.8S rRNA; this function may include MPHOSPH6. It potentiates transcriptional repression by NR1D1 and THRB. C1D nuclear receptor corepressorcan activate PRKDC not only in the presence of linear DNA but also in the presence of supercoiled DNA. It also can induce apoptosis in a p53/TP53 dependent manner.

  • Schilders G, et al. (2007) C1D is a major autoantibody target in patients with the polymyositis-scleroderma overlap syndrome. Arthritis Rheum.56(7):2449-54.
  • Schilders G, et al. (2007) C1D and hMtr4p associate with the human exosome subunit PM/Scl-100 and are involved in pre-rRNA processing. Nucleic Acids Res. 35(8):2564-72.
  • Erdemir T, et al. (2002) DNA damage-dependent interaction of the nuclear matrix protein C1D with Translin-associated factor X (TRAX). J Cell Sci. 115(Pt 1):207-16.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items