Quick Order

Mouse VSNL1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
VSNL1cDNA Clone Product Information
cDNA Size:576
cDNA Description:ORF Clone of Mus musculus visinin-like 1 DNA.
Gene Synonym:VILIP; Vnsl1
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-His Vector Information
Vector Name pCMV3-C-His
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-His Physical Map

Schematic of pCMV3-C-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Related Products
Product nameProduct name

VILIP-1, also known as VSNL1, is strongly expressed in granule cells of the cerebellum where it associates with membranes in a calcium-dependent manner and modulates intracellular signaling pathways of the central nervous system by directly or indirectly regulating the activity of adenylyl cyclase. VILIP-1 gene is a member of the visinin/recoverin subfamily of neuronal calcium sensor proteins. Alternatively spliced transcript variants have been observed, but their full-length nature has not been determined.

  • Burgoyne RD. 2007, Nat Rev Neurosci. 8 (3): 182-93.
  • Kose A. et al., 1990, Brain Res. 518 (1-2): 209-17.
  • Polymeropoulos MH. et al., 1996, Genomics. 29 (1): 273-5.