Quick Order

Text Size:AAA

Mouse SUMO1 ORF mammalian expression plasmid, N-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse SUMO1 cDNA Clone Product Information
Gene_bank_ref_id:NM_009460.2
RefSeq ORF Size:306bp
cDNA Description:Full length Clone DNA of Mus musculus SMT3 suppressor of mif two 3 homolog 1 (yeast) with N terminal HA tag.
Gene Synonym:GMP1, PIC1, SMT3, Ubl1, SMTP3, Smt3C, SMT3H3, SUMO-1, SENTRIN
Species:Mouse
Vector:pCMV3-N-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

Small ubiquitin-like modifier protein (SUMO) modification is a highly dynamic process, catalyzed by SUMO-specific activating (E1), conjugating (E2) and ligating (E3) enzymes, and reversed by a family of SUMO-specific proteases (SENPs). Small ubiquitin-like modifier 1 (SUMO1) is a member of the superfamily of ubiquitin-like proteins. Despite its structural similarity with ubiquitin, SUMO1 does not seem to play any role in protein degradation. SUMO1 plays an important role in modulation of NOX activity required for ROS generation. SUMO1 haploinsufficiency results in cleft lip and palate in animal models. SUMO1 gene variation in human non-syndromic cleft lip with or without cleft palate (NSCLP) development. SUMO-1 may be useful as a novel target for therapy in oral squamous cell carcinoma (SCC) as well as a clinical indicator for tumor recurrence together with Mdm2.

References
  • Kim HJ, et al. (2011) SUMO1 attenuates stress-induced ROS generation by inhibiting NADPH oxidase 2. Biochem Biophys Res Commun. 410(3): 555-62.
  • Zuo Y, et al. (2009) Small ubiquitin-like modifier protein-specific protease 1 and prostate cancer. Asian J Androl. 11(1): 36-8.
  • Song T, et al. (2008) SUMO1 polymorphisms are associated with non-syndromic cleft lip with or without cleft palate. Biochem Biophys Res Commun. 377(4): 1265-8.
  • Katayama A, et al. (2007) Overexpression of small ubiquitin-related modifier-1 and sumoylated Mdm2 in oral squamous cell carcinoma: possible involvement in tumor proliferation and prognosis. Int J Oncol. 31(3): 517-24.
  • Size / Price
    Catalog: MG53059-NY
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"