Quick Order

Text Size:AAA

Mouse HIST2H2BE ORF mammalian expression plasmid, N-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse HIST2H2BE cDNA Clone Product Information
Gene_bank_ref_id:NM_178214.3
RefSeq ORF Size:381bp
cDNA Description:Full length Clone DNA of Mus musculus histone cluster 2, H2be with N terminal HA tag.
Gene Synonym:T25626, H2b-613, AV127319
Species:Mouse
Vector:pCMV3-N-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

Histones are a complex family of highly conserved basic proteins responsible for packaging chromosomal DNA into nucleosomes. Histone proteins exhibit two levels of diversity: 1. evolutionary diversity between species and 2. subtype diversity in a class(H1, H2A, H2B, H3 or H4) within a species. It has become more and more evident that histone modifications are key players in the regulation of chromatin states and dynamics as well as in gene expression. Therefore, histone modifications and the enzymatic machineries that set them are crucial regulators that can control cellular proliferation, differentiation, plasticity, and malignancy processes. However, extracellular histones are a double-edged sword because they also damage host tissue and may cause death. Histones bound to platelets, induced calcium influx, and recruited plasma adhesion proteins such as fibrinogen to induce platelet aggregation. Histone H2B proteins have been studied in a variety of species and is easily detecred in most species. The reversible ubiquitylation of histone H2B has long been implicated in transcriptional activation and gene silencing. Phosphorylation of H2B serine 32 occurs in normal cycling and mitogen-stimulated cells. Notably, this phosphorylation is elevated in skin cancer cell lines and tissues compared with normal counterparts. HIST2H2BE is a member of the histone H2B family, and generates two transcripts through the use of the conserved stem-loop termination motif, and the polyA addition motif.

References
  • Fuchs TA, et al. (2011) Histones induce rapid and profound thrombocytopenia in mice. Blood. 118(13): 3708-14.
  • Collart D, et al. (1993). A human histone H2B.1 variant gene, located on chromosome 1, utilizes alternative 3' end processing. J Cell Biochem. 50 (4): 374-85.
  • Marzluff WF, et al. (2002). The human and mouse replication-dependent histone genes. Genomics. 80 (5): 487-98.
  • Size / Price
    Catalog: MG53022-NY
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"