Quick Order

Text Size:AAA

Mouse ENO3 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
ENO3cDNA Clone Product Information
Gene_bank_ref_id:NM_007933.3
cDNA Size:1305
cDNA Description:ORF Clone of Mus musculus enolase 3, beta muscle DNA.
Gene Synonym:MSE; Eno-3
Species:Mouse
Vector:pCMV3-N-HA
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Vector Information
 
Vector Name pCMV3-SP-N-HA
Vector Size 6146bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Related Products
Product nameProduct name
Background

ENO3 is one of the three enolase isoenzymes found in mammals. As a homodimer, ENO3 is found in skeletal muscle cells in the adult. A switch from alpha enolase to beta enolase occurs in muscle tissue during development in rodents. Mutations in ENO3 gene can be associated with metabolic myopathies that may result from decreased stability of the enzyme. Two transcripts have been identified for ENO3 gene that differ only in their 5' UTR. ENO3 may play a role in muscle development and regeneration. It appears to have a function in striated muscle development and regeneration.

References
  • Peshavaria M, et al. (1989) Structure of human muscle (beta) enolase mRNA and protein deduced from a genomic clone. Nucleic Acids Res. 17(21):8862.
  • Calì L, et al. (1990) Nucleotide sequence of a cDNA encoding the human muscle-specific enolase (MSE). Nucleic Acids Res. 18(7):1893.
  • Peshavaria M, et al. (1991) Molecular structure of the human muscle-specific enolase gene (ENO3). Biochem J. 275(2):427-33.
  • Size / Price
    Catalog:MG52862-NY
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
    Images
      Recently Viewed Items
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"