Quick Order

Text Size:AAA

Mouse VSNL1 ORF mammalian expression plasmid, N-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse VSNL1 cDNA Clone Product Information
Gene_bank_ref_id:NM_012038.4
RefSeq ORF Size:576bp
cDNA Description:Full length Clone DNA of Mus musculus visinin-like 1 with N terminal HA tag.
Gene Synonym:VILIP, Vnsl1
Species:Mouse
Vector:pCMV3-N-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

VILIP-1, also known as VSNL1, is strongly expressed in granule cells of the cerebellum where it associates with membranes in a calcium-dependent manner and modulates intracellular signaling pathways of the central nervous system by directly or indirectly regulating the activity of adenylyl cyclase. VILIP-1 gene is a member of the visinin/recoverin subfamily of neuronal calcium sensor proteins. Alternatively spliced transcript variants have been observed, but their full-length nature has not been determined.

References
  • Burgoyne RD. 2007, Nat Rev Neurosci. 8 (3): 182-93.
  • Kose A. et al., 1990, Brain Res. 518 (1-2): 209-17.
  • Polymeropoulos MH. et al., 1996, Genomics. 29 (1): 273-5.
  • Size / Price
    Catalog: MG52838-NY
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"