Quick Order

Text Size:AAA

Mouse SRI Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
SRIcDNA Clone Product Information
Gene_bank_ref_id:NM_025618.3
cDNA Size:552
cDNA Description:ORF Clone of Mus musculus sorcin DNA.
Gene Synonym:Sor; 2210417O06Rik; 2900070H08Rik
Species:Mouse
Vector:pCMV3-C-HA
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-HA Vector Information
 
Vector Name pCMV3-C-HA
Vector Size 6161bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-C-HA Physical Map
Schematic of pCMV3-C-HA Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Related Products
Product nameProduct name
Background

Sorcin was originally identified in multidrug-resistant cells. It is a alcium-binding protein. Sorcin modulates excitation-contraction coupling in the heart, contributes to calcium homeostasis in the heart sarcoplasmic reticulum. Sorcin is overexpressed in the multi-drug resistant chinese hamster ovary cell line CHRC5 and a variety of multidrug-resistant tumor cell lines, but overexpression is not a sufficient or necessary condition for the acquisition of the multidrug-resistant phenotype.

References
  • Meyers MB, et al. (1995) Association of sorcin with the cardiac ryanodine receptor. J Biol Chem. 270(44):26411-8.
  • Brownawell AM, et al. (1997) Calcium-dependent binding of sorcin to the N-terminal domain of synexin (annexin VII). J Biol Chem. 272(35):22182-90.
  • Hansen, et al. (2003) The PEF family proteins sorcin and grancalcin interact in vivo and in vitro. FEBS Lett. 545(2-3):151-4.
  • Size / Price
    Catalog:MG52957-CY
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
    Images
      Recently Viewed Items
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"