Quick Order

Text Size:AAA

Cynomolgus monkey UBA1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
UBA1cDNA Clone Product Information
Gene_bank_ref_id:unsubmitted
cDNA Size:3177
cDNA Description:ORF Clone of Macaca fascicularis ubiquitin-like modifier activating enzyme 1DNA.
Gene Synonym:UBA1
Species:Cynomolgus
Vector:pCMV3-untagged
Restriction Site:
Tag Sequence:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-untagged Vector Information
 
Vector Name pCMV3-untagged
Vector Size 6223bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-untagged Physical Map

Schematic of pCMV3-untagged Multiple Cloning Sites
Cynomolgus monkey UBA1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged on other vectors
Cynomolgus monkey UBA1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedCG90821-ACG$425
Cynomolgus monkey UBA1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagCG90821-ACR$425
Cynomolgus monkey UBA1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedCG90821-ANG$425
Cynomolgus monkey UBA1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-OFPSpark tagCG90821-ANR$425
Cynomolgus monkey UBA1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedCG90821-CF$395
Cynomolgus monkey UBA1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedCG90821-CH$395
Cynomolgus monkey UBA1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedCG90821-CM$395
Cynomolgus monkey UBA1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedCG90821-CY$395
Cynomolgus monkey UBA1 Gene cDNA Clone (full-length ORF Clone)CG90821-G$145
Cynomolgus monkey UBA1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedCG90821-NF$395
Cynomolgus monkey UBA1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedCG90821-NH$395
Cynomolgus monkey UBA1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedCG90821-NM$395
Cynomolgus monkey UBA1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedCG90821-NY$395
Cynomolgus monkey UBA1 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedCG90821-UT$395
 Learn more about expression Vectors
Related Products
Product nameProduct name
Background

UBE1, also known as UBA1, belongs to the ubiquitin-activating E1 family. UBE1 gene complements an X-linked mouse temperature-sensitive defect in DNA synthesis, and thus may function in DNA repair. It is part of a gene cluster on chromosome Xp11.23. UBE1 catalyzes the first step in ubiquitin conjugation to mark cellular proteins for degradation. It also catalyzes the first step in ubiquitin conjugation to mark cellular proteins for degradation by first adenylating its C-terminal glycine residue with ATP, and thereafter linking this residue to the side chain of a cysteine residue in E1, yielding an ubiquitin-E1 thioester and free AMP. Defects in UBA1 can cause spinal muscular atrophy X-linked type 2 (SMAX2), also known as X-linked lethal infantile spinal muscular atrophy, distal X-linked arthrogryposis multiplex congenita or X-linked arthrogryposis type 1 (AMCX1). Spinal muscular atrophy refers to a group of neuromuscular disorders characterized by degeneration of the anterior horn cells of the spinal cord, leading to symmetrical muscle weakness and atrophy. SMAX2 is a lethal infantile form presenting with hypotonia, areflexia, and multiple congenital contractures.

References
  • Jin J, et al. (2007) Dual E1 activation systems for ubiquitin differentially regulate E2 enzyme charging. Nature. 447(7148):1135-8.
  • Xia T, et al. (2007) Chaperone-dependent E3 ligase CHIP ubiquitinates and mediates proteasomal degradation of soluble guanylyl cyclase. Am J Physiol Heart Circ Physiol. 293(5):H3080-7.
  • Pridgeon JW, et al. (2009) Proteomic analysis reveals Hrs UIM-mediated ubiquitin signaling in multiple cellular processes. FEBS J. 276(1):118-31.
  • Size / Price
    Catalog:CG90821-UT
    List Price: $395.00  (Save $0.00)
    Price:$395.00      [How to order]
    Availability2-3 weeks
    Images
      Recently Viewed Items
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"