After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Rat FETUB Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
FETUBcDNA Clone Product Information
cDNA Size:1137
cDNA Description:ORF Clone of Rattus norvegicus fetuin B DNA.
Gene Synonym:Fet; Pp63
Restriction Site:
Tag Sequence:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-untagged Vector Information
Vector Name pCMV3-untagged
Vector Size 6223bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-untagged Physical Map

Schematic of pCMV3-untagged Multiple Cloning Sites
Related Products
Product nameProduct name

Fetuin-B, also known as Fetuin-like protein IRL685 and FETUB, is a secreted protein which belongs to the fetuin family. Fetuin-B / FETUB contains two cystatin domains. Fetuin-B is a member of the fetuin family, part of the cystatin superfamily of cysteine protease inhibitors. Fetuins have been implicated in several diverse functions, including osteogenesis and bone resorption. Fetuin-A has been identified as a major protein during fetal life and is also involved in important functions such as protease inhibitory activities and development-associated regulation of calcium metabolism and osteogenesis. Fetuin-A is a key partner in the recovery phase of an acute inflammatory response. Fetuin-B / FETUB is found at least in human and rodents. It is unambiguously a paralogue of Fetuin-A. Fetuin-A and Fetuin-B exhibit significant differences at the amino acid sequence level, notably including variations with respect to the archetypal fetuin-specific signature.

  • Olivier E., et al., 2000, Biochem. J. 350:589-97
  • Liu T., et al., 2005, J. Proteome Res. 4:2070-80.
  • Hsu SJ, et al., 2005, Genome. 47 (5): 931-46.
  • Liu T, et al., 2006, J. Proteome Res.4 (6): 2070-80.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks