Quick Order

Text Size:AAA

Mouse TMPRSS2 natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse TMPRSS2 cDNA Clone Product Information
Gene_bank_ref_id:NM_015775.2
RefSeq ORF Size:1473bp
cDNA Description:Full length Clone DNA of Mus musculus transmembrane protease, serine 2.
Gene Synonym:D16Ertd61e
Species:Mouse
Vector:pCMV3-untagged
Plasmid:pCMV3-mTMPRSS2
Restriction Site:HindIII(two restriction sites) + XbaI (6.1kb + 1.20kb + 0.28kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for the point mutations: 264C/T, 651C/T not causing the amino acid variation.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Size / Price
Catalog: MG52958-UT
List Price:   (Save )
Price:      [How to order]
AvailabilityIn StockShipping instructions
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"