After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Mouse VSNL1 natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse VSNL1 cDNA Clone Product Information
Gene_bank_ref_id:NM_012038.4
RefSeq ORF Size:576bp
cDNA Description:Full length Clone DNA of Mus musculus visinin-like 1.
Gene Synonym:VILIP, Vnsl1
Species:Mouse
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Background

VILIP-1, also known as VSNL1, is strongly expressed in granule cells of the cerebellum where it associates with membranes in a calcium-dependent manner and modulates intracellular signaling pathways of the central nervous system by directly or indirectly regulating the activity of adenylyl cyclase. VILIP-1 gene is a member of the visinin/recoverin subfamily of neuronal calcium sensor proteins. Alternatively spliced transcript variants have been observed, but their full-length nature has not been determined.

References
  • Burgoyne RD. 2007, Nat Rev Neurosci. 8 (3): 182-93.
  • Kose A. et al., 1990, Brain Res. 518 (1-2): 209-17.
  • Polymeropoulos MH. et al., 1996, Genomics. 29 (1): 273-5.
  • Size / Price
    Catalog: MG52838-UT
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"