Quick Order

Mouse LYPLA2 natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse LYPLA2 cDNA Clone Product Information
Gene_bank_ref_id:NM_011942.1
RefSeq ORF Size:696bp
cDNA Description:Full length Clone DNA of Mus musculus lysophospholipase 2.
Gene Synonym:LysoII
Species:Mouse
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Background

Lysophospholipase II (LYPLA2, LPL-II, or LysoPLA II), also known as Acyl-protein thioesterase 2 (APT-2), belongs to the AB hydrolase 2 family. This enzyme has lysophospholipase activity, and may hydrolyze fatty acids from S-acylated cysteine residues in proteins such as trimeric G alpha proteins or HRAS. Acyl-protein thioesterase 1 (APT-1) and Acyl-protein thioesterase 2 (APT-2) are cytosolic lysophospholipid hydrolyzing enzymes. The serum activity of APT-1 may play an important role in determination of the concentration of des-acyl ghrelin in circulation, especially under septic inflammation. APT-2/LYPLA2 is expressed both in CHO-K1 and HeLa cells and its overexpression increased the deacylation rate of single acylated GAP-43 and affected the steady-state localization of diacylated GAP-43 and H-Ras. Thus, the results demonstrate that APT-2/LYPLA2 is the protein thioesterase involved in the acylation/deacylation cycle operating in GAP-43 subcellular distribution.

References
  • Satou M, et al. (2010) Identification and characterization of acyl-protein thioesterase 1/lysophospholipase I as a ghrelin deacylation/lysophospholipid hydrolyzing enzyme in fetal bovine serum and conditioned medium. Endocrinology. 151(10): 4765-75.
  • Tomatis VM, et al. (2010) Acyl-protein thioesterase 2 catalyzes the deacylation of peripheral membrane-associated GAP-43. PLoS One. 5(11): e15045.
  • Size / Price
    Catalog: MG52835-UT
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"