Quick Order

Text Size:AAA

Mouse EIF3K natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse EIF3K cDNA Clone Product Information
Gene_bank_ref_id:NM_028659.3
RefSeq ORF Size:657bp
cDNA Description:Full length Clone DNA of Mus musculus eukaryotic translation initiation factor 3, subunit K.
Gene Synonym:Eif3s12; 1200009C21Rik
Species:Mouse
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Background

EIF3K is a member of the eIF3 subunit K family. It is a component of the eukaryotic translation initiation factor 3 (eIF-3) complex, which is required for several steps in the initiation of protein synthesis. The eIF-3 complex associates with the 40S ribosome and facilitates the recruitment of eIF-1, eIF-1A, eIF-2:GTP:methionyl-tRNAi and eIF-5 to form the 43S preinitiation complex (43S PIC). It stimulates mRNA recruitment to the 43S PIC and scanning of the mRNA for AUG recognition. EIF3K is universally expressed in human tissues. It is distributed both in nucleus and cytoplasm. EIF3K is the smallest subunit of eIF3 and it interacts with a number of other subunits of eIF3 and the 40S ribosomal subunit.

References
  • Rual JF. et al., 2005, Nature. 437 (7062): 1173-8.
  • Shen X. et al., 2004, FEBS Lett. 573 (1-3): 139-46.
  • Wei Z. et al., 2004, J Biol Chem. 279 (33): 34983-90.
  • Size / Price
    Catalog: MG52829-UT
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"