Quick Order

Text Size:AAA

Mouse WWP2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
WWP2cDNA Clone Product Information
cDNA Size:2613
cDNA Description:ORF Clone of Mus musculus WW domain containing E3 ubiquitin protein ligase 2 DNA.
Gene Synonym:AIP2; AA690238; AW554328; 1300010O06Rik
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-Myc Vector Information
Vector Name pCMV3-C-Myc
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-Myc Physical Map

Schematic of pCMV3-C-Myc Multiple Cloning Sites

Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Related Products
Product nameProduct name

WWP2 contains 1 C2 domain, 1 HECT (E6AP-type E3 ubiquitin-protein ligase) domain and 4 WW domains. It is an E3 ubiquitin-protein ligase which accepts ubiquitin from an E2 ubiquitin-conjugating enzyme in the form of a thioester and then directly transfers the ubiquitin to targeted substrates. WWP2 can be detected in heart, throughout the brain, placenta, lung, liver, muscle, kidney and pancreas. It is also expressed in spleen and peripheral blood leukocytes. WWP2 polyubiquitinates POU5F1 by 'Lys-63'-linked conjugation and promotes it to proteasomal degradation; in embryonic stem cells (ESCs) the ubiquitination is proposed to regulate POU5F1 protein level. WWP2 ubiquitinates EGR2 and promotes it to proteasomal degradation; in T-cells the ubiquitination inhibits activation-induced cell death. It also ubiquitinates SLC11A2; the ubiquitination is enhanced by presence of NDFIP1 and NDFIP2. WWP2 ubiquitinates RPB1 and promotes it to proteasomal degradation.

  • McDonald FJ, et al. (2002) Ubiquitin-protein ligase WWP2 binds to and downregulates the epithelial Na(+) channel. Am J Physiol Renal Physiol. 283 (3): F431-6.
  • Soond SM, et al. (2011) Selective targeting of activating and inhibitory Smads by distinct WWP2 ubiquitin ligase isoforms differentially modulates TGFβ signalling and EMT. Oncogene. 30 (21): 2451-62.
  • Marcucci R, et al. (2011) Pin1 and WWP2 regulate GluR2 Q/R site RNA editing by ADAR2 with opposing effects. EMBO J. 30 (20): 4211-22.
  • Maddika S, et al. (2011) WWP2 is an E3 ubiquitin ligase for PTEN. Nat Cell Biol. 13 (6): 728-33.
  • Xu H, et al. (2009) WWP2 promotes degradation of transcription factor OCT4 in human embryonic stem cells. Cell Res. 19 (5): 561-73.
  • Size / Price
    List Price: $395.00  (Save $0.00)
    Price:$395.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items