After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Mouse PNLIPRP1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
PNLIPRP1cDNA Clone Product Information
cDNA Size:1422
cDNA Description:ORF Clone of Mus musculus pancreatic lipase related protein 1 DNA.
Gene Synonym:Plrp1
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-N-His Vector Information
Vector Name pCMV3-N-His
Vector Size 6104bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-N-His Physical Map

Schematic of pCMV3-N-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Mouse PNLIPRP1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-tagged on other vectors
Related Products
Product nameProduct name

PNLIPRP1, also known as PLRP1, belongs to the AB hydrolase superfamily, Lipase family. PNLIPRP1 is structurally similar to PLRP2. However, these two proteins display different functional properties. PNLIPRP1 may function as inhibitor of dietary triglyceride digestion. It lacks detectable lipase activity towards triglycerides, diglycerides, phosphatidylcholine, galactolipids or cholesterol esters. PLRP2 hydrolyses milk fat with a lower catalytic efficiency than that of PL. PLRP2 activity, higher on homogenized than on native milk fat, is differently influenced by fatty acids and colipase depending on a proteolytic cleavage in the lid domain.

  • Grupe A. et al., 2006, Am J Hum Genet. 78 (1): 78-88.
  • Strausberg RL. et al., 2002, Proc Natl Acad Sci. 99 (26): 16899-903.
  • Giller T. et al., 1992, J Biol Chem. 267 (23): 16509-16.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks