Quick Order

Text Size:AAA

Mouse C1D ORF mammalian expression plasmid, N-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse C1D cDNA Clone Product Information
Gene_bank_ref_id:NM_020558.3
RefSeq ORF Size:426bp
cDNA Description:Full length Clone DNA of Mus musculus C1D nuclear receptor co-repressor with N terminal His tag.
Gene Synonym:SUN-CoR, AI875855, 1110036E10Rik
Species:Mouse
Vector:pCMV3-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

C1D nuclear receptor corepressor belongs to the C1D family. It is a DNA binding and apoptosis-inducing protein.C1D nuclear receptor corepressorinteracts with TSNAX and DNA-PKcs. It acts as a corepressor for the thyroid hormone receptor. It is thought that C1D nuclear receptor corepressor regulates TRAX/Translin complex formation. It is expressed in kidney, heart, brain, spleen, lung, testis, liver and small intestine. It plays a role in the recruitment of the RNA exosome complex to pre-rRNA to mediate the 3'-5' end processing of the 5.8S rRNA; this function may include MPHOSPH6. It potentiates transcriptional repression by NR1D1 and THRB. C1D nuclear receptor corepressorcan activate PRKDC not only in the presence of linear DNA but also in the presence of supercoiled DNA. It also can induce apoptosis in a p53/TP53 dependent manner.

References
  • Schilders G, et al. (2007) C1D is a major autoantibody target in patients with the polymyositis-scleroderma overlap syndrome. Arthritis Rheum.56(7):2449-54.
  • Schilders G, et al. (2007) C1D and hMtr4p associate with the human exosome subunit PM/Scl-100 and are involved in pre-rRNA processing. Nucleic Acids Res. 35(8):2564-72.
  • Erdemir T, et al. (2002) DNA damage-dependent interaction of the nuclear matrix protein C1D with Translin-associated factor X (TRAX). J Cell Sci. 115(Pt 1):207-16.
  • Size / Price
    Catalog: MG52866-NH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"