After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Mouse EIF3K Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
EIF3KcDNA Clone Product Information
cDNA Size:657
cDNA Description:ORF Clone of Mus musculus eukaryotic translation initiation factor 3, subunit K DNA.
Gene Synonym:Eif3s12; 1200009C21Rik
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-N-His Vector Information
Vector Name pCMV3-N-His
Vector Size 6104bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-N-His Physical Map

Schematic of pCMV3-N-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Related Products
Product nameProduct name

EIF3K is a member of the eIF3 subunit K family. It is a component of the eukaryotic translation initiation factor 3 (eIF-3) complex, which is required for several steps in the initiation of protein synthesis. The eIF-3 complex associates with the 40S ribosome and facilitates the recruitment of eIF-1, eIF-1A, eIF-2:GTP:methionyl-tRNAi and eIF-5 to form the 43S preinitiation complex (43S PIC). It stimulates mRNA recruitment to the 43S PIC and scanning of the mRNA for AUG recognition. EIF3K is universally expressed in human tissues. It is distributed both in nucleus and cytoplasm. EIF3K is the smallest subunit of eIF3 and it interacts with a number of other subunits of eIF3 and the 40S ribosomal subunit.

  • Rual JF. et al., 2005, Nature. 437 (7062): 1173-8.
  • Shen X. et al., 2004, FEBS Lett. 573 (1-3): 139-46.
  • Wei Z. et al., 2004, J Biol Chem. 279 (33): 34983-90.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items