Quick Order

Text Size:AAA

West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) NS5 ORF mammalian expression plasmid, N-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
WNV WNV-NS5 cDNA Clone Product Information
Gene_bank_ref_id:DQ211652.1
RefSeq ORF Size:2715bp
cDNA Description:Full length Clone DNA of West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) NS5 with N terminal His tag.
Gene Synonym:WNV-NS5
Species:WNV
Vector:pCMV3-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:Identical with the Gene Bank Ref. ID sequence DQ211652.1 (7681..10395), corresponding to amino acid sequence YP_001527887.1.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) NS5 ORF mammalian expression plasmid, N-His tag on other vectors
West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) NS5 ORF mammalian expression plasmid, C-GFPSpark tagVG40348-ACG$425
West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) NS5 ORF mammalian expression plasmid, C-OFPSpark / RFP tagVG40348-ACR$425
West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) NS5 ORF mammalian expression plasmid, N-GFPSpark tagVG40348-ANG$425
West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) NS5 ORF mammalian expression plasmid, N-OFPSpark / RFP tagVG40348-ANR$425
West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) NS5 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedVG40348-CF$395
West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) NS5 ORF mammalian expression plasmid, C-His tagVG40348-CH$395
West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) NS5 ORF mammalian expression plasmid, C-Myc tagVG40348-CM$395
West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) NS5 ORF mammalian expression plasmid, C-HA tagVG40348-CY$395
West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) NS5 ORF mammalian expression plasmid (Codon Optimized)VG40348-G$295
West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) NS5 ORF mammalian expression plasmid, N-Flag tagVG40348-NF$395
West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) NS5 ORF mammalian expression plasmid, N-His tagVG40348-NH$395
West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) NS5 ORF mammalian expression plasmid, N-Myc tagVG40348-NM$395
West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) NS5 ORF mammalian expression plasmid, N-HA tagVG40348-NY$395
West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) NS5 natural ORF mammalian expression plasmidVG40348-UT$395
 Learn more about expression Vectors
Product nameProduct name
Size / Price
Catalog: VG40348-NH
List Price:   (Save )
Price:      [How to order]
Availability2-3 weeksShipping instructions
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"