After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) NS5 ORF mammalian expression plasmid, N-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
WNV WNV-NS5 cDNA Clone Product Information
Gene_bank_ref_id:DQ211652.1
RefSeq ORF Size:2715bp
cDNA Description:Full length Clone DNA of West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) NS5 with N terminal His tag.
Gene Synonym:WNV-NS5
Species:WNV
Vector:pCMV3-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:Identical with the Gene Bank Ref. ID sequence DQ211652.1 (7681..10395), corresponding to amino acid sequence YP_001527887.1.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) NS5 ORF mammalian expression plasmid, N-His tag on other vectors
West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) NS5 ORF mammalian expression plasmid, C-GFPSpark tagVG40348-ACG$425
West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) NS5 ORF mammalian expression plasmid, C-OFPSpark / RFP tagVG40348-ACR$425
West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) NS5 ORF mammalian expression plasmid, N-GFPSpark tagVG40348-ANG$425
West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) NS5 ORF mammalian expression plasmid, N-OFPSpark / RFP tagVG40348-ANR$425
West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) NS5 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedVG40348-CF$395
West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) NS5 ORF mammalian expression plasmid, C-His tagVG40348-CH$395
West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) NS5 ORF mammalian expression plasmid, C-Myc tagVG40348-CM$395
West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) NS5 ORF mammalian expression plasmid, C-HA tagVG40348-CY$395
West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) NS5 ORF mammalian expression plasmid (Codon Optimized)VG40348-G$295
West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) NS5 ORF mammalian expression plasmid, N-Flag tagVG40348-NF$395
West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) NS5 ORF mammalian expression plasmid, N-His tagVG40348-NH$395
West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) NS5 ORF mammalian expression plasmid, N-Myc tagVG40348-NM$395
West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) NS5 ORF mammalian expression plasmid, N-HA tagVG40348-NY$395
West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) NS5 natural ORF mammalian expression plasmidVG40348-UT$395
 Learn more about expression Vectors
Product nameProduct name
Size / Price
Catalog: VG40348-NH
List Price:   (Save )
Price:      [How to order]
Availability2-3 weeksShipping instructions
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"