After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Rift Valley fever virus (RVFV) (strain MP12) NSs ORF mammalian expression plasmid, N-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
RVFV RVFV-NSs cDNA Clone Product Information
Gene_bank_ref_id:DQ380154.1
RefSeq ORF Size:798bp
cDNA Description:Full length Clone DNA of Rift Valley fever virus (RVFV) (strain MP12) NSs with N terminal His tag.
Gene Synonym:RVFV-NSs
Species:RVFV
Vector:pCMV3-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Rift Valley fever virus (RVFV) (strain MP12) NSs ORF mammalian expression plasmid, N-His tag on other vectors
Rift Valley fever virus (RVFV) (strain MP12) NSs ORF mammalian expression plasmid, C-GFPSpark tagVG40339-ACG$325
Rift Valley fever virus (RVFV) (strain MP12) NSs ORF mammalian expression plasmid, C-OFPSpark / RFP tagVG40339-ACR$325
Rift Valley fever virus (RVFV) (strain MP12) NSs ORF mammalian expression plasmid, N-GFPSpark tagVG40339-ANG$325
Rift Valley fever virus (RVFV) (strain MP12) NSs ORF mammalian expression plasmid, N-OFPSpark / RFP tagVG40339-ANR$325
Rift Valley fever virus (RVFV) (strain MP12) NSs Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedVG40339-CF$295
Rift Valley fever virus (RVFV) (strain MP12) NSs ORF mammalian expression plasmid, C-His tagVG40339-CH$295
Rift Valley fever virus (RVFV) (strain MP12) NSs ORF mammalian expression plasmid, C-Myc tagVG40339-CM$295
Rift Valley fever virus (RVFV) (strain MP12) NSs ORF mammalian expression plasmid, C-HA tagVG40339-CY$295
Rift Valley fever virus (RVFV) (strain MP12) NSs ORF mammalian expression plasmid (Codon Optimized)VG40339-G$95
Rift Valley fever virus (RVFV) (strain MP12) NSs ORF mammalian expression plasmid, N-Flag tagVG40339-NF$295
Rift Valley fever virus (RVFV) (strain MP12) NSs ORF mammalian expression plasmid, N-His tagVG40339-NH$295
Rift Valley fever virus (RVFV) (strain MP12) NSs ORF mammalian expression plasmid, N-Myc tagVG40339-NM$295
Rift Valley fever virus (RVFV) (strain MP12) NSs ORF mammalian expression plasmid, N-HA tagVG40339-NY$295
Rift Valley fever virus (RVFV) (strain MP12) NSs natural ORF mammalian expression plasmidVG40339-UT$295
 Learn more about expression Vectors
Product nameProduct name
Size / Price
Catalog: VG40339-NH
List Price:   (Save )
Price:      [How to order]
Availability2-3 weeksShipping instructions
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"