After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Nipah virus (NiV) (strain Bangladesh (NiV-B)) N ORF mammalian expression plasmid, N-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
NiV NiV-N cDNA Clone Product Information
NCBI RefSeq:AY988601.1
RefSeq ORF Size:1599bp
cDNA Description:Full length Clone DNA of Nipah virus (NiV) (strain Bangladesh (NiV-B)) N with N terminal His tag.
Gene Synonym:NiV-N
Species:NiV
Vector:pCMV3-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Nipah virus (NiV) (strain Bangladesh (NiV-B)) N ORF mammalian expression plasmid, N-His tag on other vectors
Nipah virus (NiV) (strain Bangladesh (NiV-B)) N ORF mammalian expression plasmid, C-GFPSpark tagVG40331-ACG$345
Nipah virus (NiV) (strain Bangladesh (NiV-B)) N ORF mammalian expression plasmid, C-OFPSpark / RFP tagVG40331-ACR$345
Nipah virus (NiV) (strain Bangladesh (NiV-B)) N ORF mammalian expression plasmid, N-GFPSpark tagVG40331-ANG$345
Nipah virus (NiV) (strain Bangladesh (NiV-B)) N ORF mammalian expression plasmid, N-OFPSpark / RFP tagVG40331-ANR$345
Nipah virus (NiV) (strain Bangladesh (NiV-B)) N Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedVG40331-CF$315
Nipah virus (NiV) (strain Bangladesh (NiV-B)) N ORF mammalian expression plasmid, C-His tagVG40331-CH$315
Nipah virus (NiV) (strain Bangladesh (NiV-B)) N ORF mammalian expression plasmid, C-Myc tagVG40331-CM$315
Nipah virus (NiV) (strain Bangladesh (NiV-B)) N ORF mammalian expression plasmid, C-HA tagVG40331-CY$315
Nipah virus (NiV) (strain Bangladesh (NiV-B)) N ORF mammalian expression plasmid (Codon Optimized)VG40331-G$195
Nipah virus (NiV) (strain Bangladesh (NiV-B)) N ORF mammalian expression plasmid, N-Flag tagVG40331-NF$315
Nipah virus (NiV) (strain Bangladesh (NiV-B)) N ORF mammalian expression plasmid, N-His tagVG40331-NH$315
Nipah virus (NiV) (strain Bangladesh (NiV-B)) N ORF mammalian expression plasmid, N-Myc tagVG40331-NM$315
Nipah virus (NiV) (strain Bangladesh (NiV-B)) N ORF mammalian expression plasmid, N-HA tagVG40331-NY$315
Nipah virus (NiV) (strain Bangladesh (NiV-B)) N natural ORF mammalian expression plasmidVG40331-UT$315
 Learn more about expression Vectors
Product nameProduct name
Size / Price
Catalog: VG40331-NH
List Price:   (Save )
Price:      [How to order]
Availability2-3 weeksShipping instructions
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"