After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Plasmodium falciparum (strain 3D7) AMA1 Gene cDNA Clone / ORF Clone (extracellular domain, ECD), expression ready, N-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
AMA1cDNA Clone Product Information
Gene_bank_ref_id:XM_001347979.1
cDNA Size:1635
cDNA Description:ORF Clone of Plasmodium falciparum (strain 3D7) apical membrane antigen 1 (extracellular domain, ECD) DNA.
Gene Synonym:AMA1
Species:P. falciparum
Vector:pCMV3-N-His
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-His (suitable for secretary and membane protein expession) Vector Information
 
Vector Name pCMV3-SP-N-His
Vector Size 6149bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-SP-N-His (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-His (suitable for secretary and membane protein expession) Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Plasmodium falciparum (strain 3D7) AMA1 Gene cDNA Clone / ORF Clone (extracellular domain, ECD), expression ready, N-His-tagged on other vectors
Plasmodium falciparum (strain 3D7) AMA1 Gene cDNA Clone / ORF Clone (extracellular domain, ECD), expression ready, C-GFPSpark-taggedVG40296-ACG$345
Plasmodium falciparum (strain 3D7) AMA1 Gene cDNA Clone / ORF Clone (extracellular domain, ECD), expression ready, C-OFPSpark tagVG40296-ACR$345
Plasmodium falciparum (strain 3D7) AMA1 Gene cDNA Clone / ORF Clone (extracellular domain, ECD), expression ready, C-FLAG-taggedVG40296-CF$315
Plasmodium falciparum (strain 3D7) AMA1 Gene cDNA Clone / ORF Clone (extracellular domain, ECD), expression ready, C-His-taggedVG40296-CH$315
Plasmodium falciparum (strain 3D7) AMA1 Gene cDNA Clone / ORF Clone (extracellular domain, ECD), expression ready, C-Myc-taggedVG40296-CM$315
Plasmodium falciparum (strain 3D7) AMA1 Gene cDNA Clone / ORF Clone (extracellular domain, ECD), expression ready, C-HA-taggedVG40296-CY$315
Plasmodium falciparum (strain 3D7) AMA1 Gene cDNA Clone / ORF Clone (extracellular domain, ECD)VG40296-G$195
Plasmodium falciparum (strain 3D7) AMA1 Gene cDNA Clone / ORF Clone (extracellular domain, ECD), expression ready, N-FLAG-taggedVG40296-NF$315
Plasmodium falciparum (strain 3D7) AMA1 Gene cDNA Clone / ORF Clone (extracellular domain, ECD), expression ready, N-His-taggedVG40296-NH$315
Plasmodium falciparum (strain 3D7) AMA1 Gene cDNA Clone / ORF Clone (extracellular domain, ECD), expression ready, N-Myc-taggedVG40296-NM$315
Plasmodium falciparum (strain 3D7) AMA1 Gene cDNA Clone / ORF Clone (extracellular domain, ECD), expression ready, N-HA-taggedVG40296-NY$315
Plasmodium falciparum (strain 3D7) AMA1 Gene cDNA Clone / ORF Clone (extracellular domain, ECD), expression ready, untaggedVG40296-UT$315
 Learn more about expression Vectors
Related Products
Product nameProduct name
Size / Price
Catalog:VG40296-NH
List Price: $315.00  (Save $0.00)
Price:$315.00      [How to order]
Availability2-3 weeks
Images
    Recently Viewed Items
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"