Quick Order

Text Size:AAA

Hepatitis C virus (HCV-1a) NS5B Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
HCV-NS5BcDNA Clone Product Information
Gene_bank_ref_id:NC_004102.1
cDNA Size:1773
cDNA Description:ORF Clone of Hepatitis C virus (HCV) (serotype 1a, isolate H77) NS5B DNA.
Gene Synonym:HCV-NS5B
Species:HCV
Vector:pCMV3-N-His
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-N-His Vector Information
 
Vector Name pCMV3-N-His
Vector Size 6104bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-N-His Physical Map

Schematic of pCMV3-N-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Hepatitis C virus (HCV-1a) NS5B Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-tagged on other vectors
Hepatitis C virus (HCV-1a) NS5B Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedVG40285-ACG$345
Hepatitis C virus (HCV-1a) NS5B Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagVG40285-ACR$345
Hepatitis C virus (HCV-1a) NS5B Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedVG40285-ANG$345
Hepatitis C virus (HCV-1a) NS5B Gene cDNA Clone (full-length ORF Clone), expression ready, N-OFPSpark tagVG40285-ANR$345
Hepatitis C virus (HCV-1a) NS5B Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedVG40285-CF$315
Hepatitis C virus (HCV-1a) NS5B Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedVG40285-CH$315
Hepatitis C virus (HCV-1a) NS5B Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedVG40285-CM$315
Hepatitis C virus (HCV-1a) NS5B Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedVG40285-CY$315
Hepatitis C virus (HCV-1a) NS5B Gene cDNA Clone (full-length ORF Clone)VG40285-G$195
Hepatitis C virus (HCV-1a) NS5B Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedVG40285-NF$315
Hepatitis C virus (HCV-1a) NS5B Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedVG40285-NH$315
Hepatitis C virus (HCV-1a) NS5B Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedVG40285-NM$315
Hepatitis C virus (HCV-1a) NS5B Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedVG40285-NY$315
Hepatitis C virus (HCV-1a) NS5B Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedVG40285-UT$315
 Learn more about expression Vectors
Related Products
Product nameProduct name
Size / Price
Catalog:VG40285-NH
List Price: $315.00  (Save $0.00)
Price:$315.00      [How to order]
Availability2-3 weeks
Images
    Recently Viewed Items
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"